Configure Image
 
Image width:pixels
Label area width:characters
Text size:
Font:
Style:
Tooltip text size:
Maximum track load time: seconds
Show light blue vertical guidelines, or light red vertical window separators in multi-region view
Display labels to the left of items in tracks
Display description above each track
Show track controls under main graphic
Next/previous item navigation
Next/previous exon navigation
Show exon numbers
Show move left/right limit buttons under image
Enable highlight with drag-and-select (if unchecked, drag-and-select always zooms to selection)
Enable pop-up when clicking items

Configure Tracks on UCSC Genome Browser: S. cerevisiae Apr. 2011 (SacCer_Apr2011/sacCer3)
  Tracks:    Groups:
Control track and group visibility more selectively below.
-   Mapping and Sequencing    
Base Position Chromosome position in bases. (Clicks here zoom in 3x)
WashU Clones Washington University Clones
Assembly Assembly from Fragments
Gap Gap Locations
GC Percent GC Percent in 5-Base Windows
Restr Enzymes Restriction Enzymes from REBASE
Short Match Perfect Matches to Short Sequence (CAGCAGCAGCAGCAGCAGCAG)
-   Genes and Gene Predictions    
NCBI RefSeq RefSeq genes from NCBI
SGD Genes Protein-Coding Genes from Saccharomyces Genome Database
SGD Other Other Features from Saccharomyces Genome Database
AUGUSTUS AUGUSTUS ab initio gene predictions v3.1
CRISPR CRISPR/Cas9 Sp. Pyog. target sites
     CRISPR Targets     CRISPR/Cas9 -NGG Targets
     CRISPR Regions     Genome regions processed to find CRISPR/Cas9 target sites (exons +/- 200 bp)
Ensembl Genes Ensembl Genes
Human Proteins Human Proteins Mapped by Chained tBLASTn
Other RefSeq Non-S. cerevisiae RefSeq Genes
UniProt UniProt SwissProt/TrEMBL Protein Annotations
-   mRNA and EST    
S. cer. ESTs S. cerevisiae ESTs Including Unspliced
S. cer. mRNAs S. cerevisiae mRNAs from GenBank
Spliced ESTs S. cerevisiae ESTs That Have Been Spliced
-   Expression and Regulation    
Regulatory Code Transcriptional Regulatory Code from Harbison Gordon et al.
Reg. ChIP-chip ChIP-chip Results from Harbison Gordon et al.
ORegAnno Regulatory elements from ORegAnno
Reg. Module Eran Segal Regulatory Module
-   Comparative Genomics    
Conservation Multiz Alignment & Conservation (7 Yeasts)
-   Variation and Repeats    
new EVA SNP Short Genetic Variants from European Variant Archive
Microsatellite Microsatellites - Di-nucleotide and Tri-nucleotide Repeats
Simple Repeats Simple Tandem Repeats by TRF