Configure Image
 
Image width:pixels
Label area width:characters
Text size:
Font:
Style:
Tooltip text size:
Maximum track load time: seconds
Display chromosome ideogram above main graphic
Show light blue vertical guidelines, or light red vertical window separators in multi-region view
Display labels to the left of items in tracks
Display description above each track
Show track controls under main graphic
Next/previous item navigation
Next/previous exon navigation
Show exon numbers
Show move left/right limit buttons under image
Enable highlight with drag-and-select (if unchecked, drag-and-select always zooms to selection)
Enable pop-up when clicking items

Configure Tracks on UCSC Genome Browser: Human Jan. 2022 (T2T CHM13v2.0/hs1) (hs1)
  Tracks:    Groups:
Control track and group visibility more selectively below.
-   Mapping and Sequencing    
Base Position Chromosome position in bases. (Clicks here zoom in 3x)
CenSat Annotation Centromeric Satellite Annotation
CHM13 unique CHM13 unique in comparison to GRCh38/hg38 and GRCh37/hg19
rDNA models Consensus rDNA models
Assembly Assembly from NCBI Genbank Sequences
GC Percent GC Percent in 5-Base Windows
Human liftOver LiftOver alignments from CHM13 to hg19/hg38 and HG002 with two different pipelines
Mappability Single-read and multi-read mappability by Umap
Microsatellites Microsatellite repeats
new Problematic Regions Difficult regions from GIAB via NCBI
Restr Enzymes Restriction Enzymes from REBASE
Short Match Perfect Matches to Short Sequence (CAGCAGCAGCAGCAGCAGCAG)
-   Genes and Gene Predictions    
CAT/Liftoff Genes CAT + Liftoff Gene Annotations
NCBI RefSeq RefSeq gene predictions from NCBI
CRISPR Targets CRISPR/Cas9 -NGG Targets, whole genome
-   Phenotype and Literature    
ClinVar Variants ClinVar Variants 20220313 (lifted)
GWAS Variants GWAS Variants 2022-03-08 (lifted)
-   mRNA and EST    
CHM13 PROseq CHM13 PROseq stranded with unique genome-wide kmer filtering
CHM13 RNA-Seq CHM13 RNA-Seq (paired-end) unique genome-wide kmer filtering (unstranded)
RefSeq mRNAs RefSeq mRNAs mapped to this assembly
-   Expression and Regulation    
CpG Islands CpG Islands (Islands < 300 Bases are Light Green)
T2T Encode T2T Encode Reanalysis
+   Comparative Genomics    
+   Variation and Repeats